|
Left Crispr |
Right Crispr |
| Crispr ID |
910320949 |
910320952 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:85943281-85943303
|
1:85943298-85943320
|
| Sequence |
CCAAGCTACTGGCATCCCAGGGT |
CAGGGTCTCCAGTTTGCAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 25, 3: 67, 4: 248} |
{0: 3, 1: 30, 2: 187, 3: 387, 4: 778} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|