ID: 910368839_910368846

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 910368839 910368846
Species Human (GRCh38) Human (GRCh38)
Location 1:86494585-86494607 1:86494610-86494632
Sequence CCATTTCCCCACAATTCCTACAT CAAAATGCTGGAAAACATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 147, 4: 862} {0: 1, 1: 0, 2: 1, 3: 40, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!