ID: 910375244_910375248

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 910375244 910375248
Species Human (GRCh38) Human (GRCh38)
Location 1:86561779-86561801 1:86561795-86561817
Sequence CCGTATCCCACACCTCAACCCTA AACCCTATTCTATTACTGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 346} {0: 1, 1: 0, 2: 2, 3: 16, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!