ID: 910414264_910414270

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 910414264 910414270
Species Human (GRCh38) Human (GRCh38)
Location 1:86981640-86981662 1:86981672-86981694
Sequence CCATGTCTCACATCCAGGACACA GGGATAGGCTCCCACGGCCTTGG
Strand - +
Off-target summary {0: 20, 1: 575, 2: 1133, 3: 1681, 4: 1777} {0: 1, 1: 2, 2: 59, 3: 395, 4: 1163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!