ID: 910422427_910422437

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 910422427 910422437
Species Human (GRCh38) Human (GRCh38)
Location 1:87080731-87080753 1:87080768-87080790
Sequence CCACATGGCGCAGAAAGAGAATC GGGGAGAGCACAGTGATTGCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 19, 3: 50, 4: 174} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!