ID: 910448919_910448937

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 910448919 910448937
Species Human (GRCh38) Human (GRCh38)
Location 1:87328205-87328227 1:87328256-87328278
Sequence CCGGGTCGCGAAGGGCAGCCCAA CACTTCACCCCACCTGATTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 43} {0: 1, 1: 0, 2: 2, 3: 4, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!