ID: 910892220_910892223

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 910892220 910892223
Species Human (GRCh38) Human (GRCh38)
Location 1:92030012-92030034 1:92030032-92030054
Sequence CCTGGCGCGCTGCGGCGCTCGCT GCTCACCCGCTCCCGAGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 102} {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!