ID: 911003338_911003340

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 911003338 911003340
Species Human (GRCh38) Human (GRCh38)
Location 1:93190921-93190943 1:93190934-93190956
Sequence CCACTCTGCTTCCTGTCATATCG TGTCATATCGACACTTTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 11, 3: 18, 4: 210} {0: 1, 1: 0, 2: 1, 3: 19, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!