ID: 911044757_911044762

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 911044757 911044762
Species Human (GRCh38) Human (GRCh38)
Location 1:93619250-93619272 1:93619282-93619304
Sequence CCATGGTTTTTAGTTTCTGTCTC GTGGAAAAGAGGGATGAGGAAGG
Strand - +
Off-target summary No data {0: 24, 1: 33, 2: 46, 3: 144, 4: 1147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!