ID: 911104159_911104167

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 911104159 911104167
Species Human (GRCh38) Human (GRCh38)
Location 1:94117103-94117125 1:94117119-94117141
Sequence CCTCCTCTCTTTACCATTCAATC TTCAATCAACATGGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 280} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!