|
Left Crispr |
Right Crispr |
Crispr ID |
911109097 |
911109099 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:94164180-94164202
|
1:94164207-94164229
|
Sequence |
CCAAGAGTTGTCTCTCAAATGGA |
AGTTATCTTCAGAAGATGGCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 18, 2: 203, 3: 201, 4: 332} |
{0: 5, 1: 197, 2: 186, 3: 120, 4: 255} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|