ID: 911109097_911109099

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 911109097 911109099
Species Human (GRCh38) Human (GRCh38)
Location 1:94164180-94164202 1:94164207-94164229
Sequence CCAAGAGTTGTCTCTCAAATGGA AGTTATCTTCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 2, 1: 18, 2: 203, 3: 201, 4: 332} {0: 5, 1: 197, 2: 186, 3: 120, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!