ID: 911198911_911198917

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 911198911 911198917
Species Human (GRCh38) Human (GRCh38)
Location 1:95024231-95024253 1:95024265-95024287
Sequence CCTCCCAAAGTGCTGGGATTATA CCGCGCCCGGCCTTTTAAATAGG
Strand - +
Off-target summary {0: 26361, 1: 319744, 2: 258545, 3: 142388, 4: 133448} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!