ID: 911413415_911413425

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 911413415 911413425
Species Human (GRCh38) Human (GRCh38)
Location 1:97540267-97540289 1:97540306-97540328
Sequence CCACAACCCCTTCTTCGGGTTAG AGCTTACAGAACCCGGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 184} {0: 1, 1: 0, 2: 0, 3: 11, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!