ID: 911413417_911413440

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 911413417 911413440
Species Human (GRCh38) Human (GRCh38)
Location 1:97540274-97540296 1:97540327-97540349
Sequence CCCTTCTTCGGGTTAGATTAACT GGGGTGGGGGGTGGGGGTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 201} {0: 5, 1: 66, 2: 723, 3: 3839, 4: 13663}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!