ID: 911430083_911430093

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 911430083 911430093
Species Human (GRCh38) Human (GRCh38)
Location 1:97774105-97774127 1:97774152-97774174
Sequence CCCCTAGGGGTTTGAGCTTTGGG CCGTTGCATGCCCTGTGAGGGGG
Strand - +
Off-target summary {0: 2, 1: 12, 2: 40, 3: 138, 4: 297} {0: 1, 1: 7, 2: 30, 3: 96, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!