ID: 911505236_911505239

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 911505236 911505239
Species Human (GRCh38) Human (GRCh38)
Location 1:98740965-98740987 1:98740987-98741009
Sequence CCAGTAAAACAAAATCAAGAAGT TTGGAGCCCTTAAATGATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 509} {0: 1, 1: 0, 2: 1, 3: 8, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!