|
Left Crispr |
Right Crispr |
Crispr ID |
911506373 |
911506378 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:98757466-98757488
|
1:98757489-98757511
|
Sequence |
CCAGATTTCCTCTTCTTATAAGG |
ACACCAGTCATATTGGATTAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 9, 1: 140, 2: 478, 3: 958, 4: 1553} |
{0: 235, 1: 883, 2: 1637, 3: 2139, 4: 1994} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|