ID: 911553421_911553427

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 911553421 911553427
Species Human (GRCh38) Human (GRCh38)
Location 1:99312720-99312742 1:99312734-99312756
Sequence CCACAATTTCCAAGCAGAAGTAG CAGAAGTAGGAGTAGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 211} {0: 1, 1: 0, 2: 2, 3: 92, 4: 1008}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!