ID: 911624941_911624943

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 911624941 911624943
Species Human (GRCh38) Human (GRCh38)
Location 1:100112988-100113010 1:100113026-100113048
Sequence CCTAACAATCCTATCAGAAAGTG AACAAATCCTTCAGTCACTCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 63, 3: 295, 4: 696} {0: 1, 1: 0, 2: 0, 3: 15, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!