ID: 911661174_911661178

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 911661174 911661178
Species Human (GRCh38) Human (GRCh38)
Location 1:100503043-100503065 1:100503058-100503080
Sequence CCCCCTTTAACTTTGCTTAGAAA CTTAGAAAACCTCCTGTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 256} {0: 1, 1: 0, 2: 2, 3: 17, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!