ID: 911866116_911866117

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 911866116 911866117
Species Human (GRCh38) Human (GRCh38)
Location 1:103024286-103024308 1:103024301-103024323
Sequence CCAGCTTATTCATTGATTGATTT ATTGATTTATTTGTAAAGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 65, 3: 555, 4: 4573}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!