ID: 911870037_911870038

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 911870037 911870038
Species Human (GRCh38) Human (GRCh38)
Location 1:103085622-103085644 1:103085646-103085668
Sequence CCTATATTCAAAAACAAGCAAAA ATTCAGAGTAGACCATATGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 122, 4: 1425} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!