ID: 911915727_911915734

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 911915727 911915734
Species Human (GRCh38) Human (GRCh38)
Location 1:103696644-103696666 1:103696682-103696704
Sequence CCTTCCGTATTCTGTTTCTCCCT TAGTCCTTGTCGCATATCCCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 37, 4: 505} {0: 3, 1: 0, 2: 0, 3: 3, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!