ID: 912167425_912167432

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 912167425 912167432
Species Human (GRCh38) Human (GRCh38)
Location 1:107057267-107057289 1:107057297-107057319
Sequence CCTGCCGGCCTCCGCCGAGCTCT CCCCATCAGCGACCAGATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 160} {0: 1, 1: 0, 2: 1, 3: 12, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!