ID: 912212731_912212739

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 912212731 912212739
Species Human (GRCh38) Human (GRCh38)
Location 1:107572373-107572395 1:107572389-107572411
Sequence CCCAGGTCATCTTTGTGTGTGTG GTGTGTGCGGGGGAGGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 159, 4: 952} {0: 1, 1: 0, 2: 6, 3: 169, 4: 1366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!