ID: 912234788_912234792

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 912234788 912234792
Species Human (GRCh38) Human (GRCh38)
Location 1:107837946-107837968 1:107837970-107837992
Sequence CCTAGGAAATACTCTTCTCAACA GGGACCTGGCAAATAATTCATGG
Strand - +
Off-target summary {0: 17, 1: 75, 2: 196, 3: 492, 4: 1359} {0: 1, 1: 0, 2: 0, 3: 16, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!