ID: 912265484_912265489

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 912265484 912265489
Species Human (GRCh38) Human (GRCh38)
Location 1:108152894-108152916 1:108152926-108152948
Sequence CCTGAGTAAGTACTAAAGGGCAT TATGACATATAGAAAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 127} {0: 1, 1: 0, 2: 1, 3: 29, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!