ID: 912267198_912267200

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 912267198 912267200
Species Human (GRCh38) Human (GRCh38)
Location 1:108170340-108170362 1:108170353-108170375
Sequence CCAGTTCTTTGAAATGTGTTGAA ATGTGTTGAACCTGGCTTTATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 49, 4: 403} {0: 1, 1: 0, 2: 3, 3: 26, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!