ID: 912267504_912267508

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 912267504 912267508
Species Human (GRCh38) Human (GRCh38)
Location 1:108173739-108173761 1:108173766-108173788
Sequence CCCAGAGACTTGTTGAATTGCTT CAAAATGCTGATAGTAATATGGG
Strand - +
Off-target summary {0: 23, 1: 1537, 2: 1943, 3: 1506, 4: 994} {0: 9, 1: 53, 2: 87, 3: 87, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!