|
Left Crispr |
Right Crispr |
Crispr ID |
912267504 |
912267508 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:108173739-108173761
|
1:108173766-108173788
|
Sequence |
CCCAGAGACTTGTTGAATTGCTT |
CAAAATGCTGATAGTAATATGGG |
Strand |
- |
+ |
Off-target summary |
{0: 23, 1: 1537, 2: 1943, 3: 1506, 4: 994} |
{0: 9, 1: 53, 2: 87, 3: 87, 4: 351} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|