ID: 912269511_912269512

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 912269511 912269512
Species Human (GRCh38) Human (GRCh38)
Location 1:108194494-108194516 1:108194520-108194542
Sequence CCAGGGTGATAAGGAAAACAGGC CAGCATTTAACAGAATTGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 20, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!