ID: 912273143_912273154

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 912273143 912273154
Species Human (GRCh38) Human (GRCh38)
Location 1:108230143-108230165 1:108230194-108230216
Sequence CCCTTGATCCCTGAATGGTTTAT CAGGGCATACAGCAGGTGCAAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 25, 4: 221} {0: 2, 1: 1, 2: 3, 3: 44, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!