ID: 912293222_912293225

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 912293222 912293225
Species Human (GRCh38) Human (GRCh38)
Location 1:108447356-108447378 1:108447408-108447430
Sequence CCAGTTTTCTCCAAGCTGCTCAA AATTCAAACTTCAGCAGACATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 25, 3: 17, 4: 261} {0: 4, 1: 7, 2: 2, 3: 16, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!