ID: 912295596_912295601

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 912295596 912295601
Species Human (GRCh38) Human (GRCh38)
Location 1:108467752-108467774 1:108467791-108467813
Sequence CCATTTGTTCTCTCCAACAGCTG GTCTTAGCTCTGTGTCCCATGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 25, 4: 267} {0: 3, 1: 0, 2: 8, 3: 21, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!