ID: 912331984_912331994

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 912331984 912331994
Species Human (GRCh38) Human (GRCh38)
Location 1:108828341-108828363 1:108828380-108828402
Sequence CCTTCCTGTGGCCCACCTGCAGC AGAAATCCCAACTCCTCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 388} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!