ID: 912458454_912458467

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 912458454 912458467
Species Human (GRCh38) Human (GRCh38)
Location 1:109815567-109815589 1:109815619-109815641
Sequence CCAGGGTGGGTAGGGCCTCAGGG CTGGTGTACCACCTGGTGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!