ID: 912474313_912474322

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 912474313 912474322
Species Human (GRCh38) Human (GRCh38)
Location 1:109925832-109925854 1:109925859-109925881
Sequence CCCAGCTCCCTGCCTAGCCACAG TGCCATCTTCCAGTCAGACTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 67, 4: 516} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!