ID: 912567668_912567674

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 912567668 912567674
Species Human (GRCh38) Human (GRCh38)
Location 1:110599886-110599908 1:110599902-110599924
Sequence CCAGGTACTTTCACACCCTGCAC CCTGCACCCAGGTTTCTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 138} {0: 1, 1: 0, 2: 6, 3: 22, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!