ID: 912576049_912576058

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 912576049 912576058
Species Human (GRCh38) Human (GRCh38)
Location 1:110674106-110674128 1:110674134-110674156
Sequence CCCCGGGCCGGCCCGGAGCTCTC ACTCGAAGAGCAGCCACACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 163} {0: 2, 1: 1, 2: 2, 3: 6, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!