ID: 912630576_912630578

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 912630576 912630578
Species Human (GRCh38) Human (GRCh38)
Location 1:111243273-111243295 1:111243288-111243310
Sequence CCAGGAATTCTCATGTGGGATTC TGGGATTCCCCTTGCCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 137} {0: 1, 1: 0, 2: 2, 3: 23, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!