ID: 912698881_912698895

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 912698881 912698895
Species Human (GRCh38) Human (GRCh38)
Location 1:111861536-111861558 1:111861569-111861591
Sequence CCCACTGCAGGACCTTGTTCCTG GGGAAGCGGGTGGCAGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 248} {0: 1, 1: 1, 2: 10, 3: 171, 4: 1355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!