ID: 912698887_912698896

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 912698887 912698896
Species Human (GRCh38) Human (GRCh38)
Location 1:111861555-111861577 1:111861577-111861599
Sequence CCTGTGTTTACGGAGGGAAGCGG GGTGGCAGGAGGGGGCCCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68} {0: 1, 1: 0, 2: 5, 3: 60, 4: 530}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!