ID: 912702001_912702005

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 912702001 912702005
Species Human (GRCh38) Human (GRCh38)
Location 1:111884965-111884987 1:111885010-111885032
Sequence CCCACTAGATGCCAGTAGCATCT ACCAAAAATGTCTCCAGACATGG
Strand - +
Off-target summary {0: 12, 1: 106, 2: 463, 3: 970, 4: 1506} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!