ID: 912703908_912703916

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 912703908 912703916
Species Human (GRCh38) Human (GRCh38)
Location 1:111897954-111897976 1:111897987-111898009
Sequence CCACCTTCCTTCCATAAACACGG TCTCCAGCCTCATTGGTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 160} {0: 1, 1: 0, 2: 0, 3: 26, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!