ID: 912706446_912706456

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 912706446 912706456
Species Human (GRCh38) Human (GRCh38)
Location 1:111918575-111918597 1:111918598-111918620
Sequence CCATGGTGCTTTGGGGGCACAGA GGATTTGGGGAAGGGGAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 247} {0: 1, 1: 1, 2: 18, 3: 179, 4: 1367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!