ID: 912710770_912710783

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 912710770 912710783
Species Human (GRCh38) Human (GRCh38)
Location 1:111948350-111948372 1:111948389-111948411
Sequence CCCACAGAGCCTGTGATTCACAG CCTGAGGTGGCGTAGGGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 193} {0: 1, 1: 0, 2: 1, 3: 32, 4: 433}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!