ID: 912775138_912775147

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 912775138 912775147
Species Human (GRCh38) Human (GRCh38)
Location 1:112502117-112502139 1:112502153-112502175
Sequence CCTCACTCTGCGGCTCGCTCTCC CGCGCAGGTGCTGCGCCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 211} {0: 1, 1: 0, 2: 1, 3: 8, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!