ID: 912780174_912780181

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 912780174 912780181
Species Human (GRCh38) Human (GRCh38)
Location 1:112539130-112539152 1:112539180-112539202
Sequence CCAAGCTTTAAATGTATATATAG AGATTCTGATTCAGAAGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 407} {0: 10, 1: 149, 2: 755, 3: 1782, 4: 3023}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!