ID: 912831324_912831328

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 912831324 912831328
Species Human (GRCh38) Human (GRCh38)
Location 1:112956325-112956347 1:112956351-112956373
Sequence CCACACGCTTTCAGCCGCGCGCG TCTAGCTCGCCCGCGCGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!