ID: 912861517_912861524

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 912861517 912861524
Species Human (GRCh38) Human (GRCh38)
Location 1:113218063-113218085 1:113218104-113218126
Sequence CCCTGCCCACAATGGTGCTAGCC GACCCAGGAAGCAAGTCACATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!