ID: 912879124_912879136

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 912879124 912879136
Species Human (GRCh38) Human (GRCh38)
Location 1:113390950-113390972 1:113390981-113391003
Sequence CCAGGGCCCCCGGGCTGAGACGG CGGCGCCCCGGCCGCCCGCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 253} {0: 1, 1: 0, 2: 3, 3: 66, 4: 434}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!